%PDF-1.7 Monsters Theme: 6 Google Forms (6 Pictures) with 10 Questions. . Student Exploration Rna And Protein Synthesis Answer Key Pdf Pdf is handy in our digital library an online permission to it is set as public for that reason you can download it instantly. . The process by which the information from DNA is transferred into the language of proteins is known as translation. Questions: Answer the following questions in complete sentences. How are the letters of the genetic alphabet A-T-C-G responsible for manufacturing proteins? An old rubber band breaks when pulled. AAU = dressesACG = funny . Keys for making cards: *Key to tRNA Cards with Words (Note: write the anticodon on one side of the card, and write the word on the other): UAG = Stop (period) CCG = is CGC = waterAUG = Initiator (Start) CCU = subject CGG = everyAAA = Your CGA = drink CGU = dayAAC = mother . 2 0 obj . UGU = littleUUA = DNA . . Using a hyphen (-) to separate each amino acid number, record this information in the appropriate place in the Data Table. tRNA uses (anticodons/codons) to match the mRNA. -D M Your mother dresses you funny. Use the amino acid sequence to determine the different colors of the monster. Use the terms base, deoxyribose, and phosphate. . Use the DNA - Studocu General Biology: Protein Synthesis Worksheet and Answer Key protein synthesis worksheet directions: use the dna code to create your mrna code. % to see state-specific standards (only available in the US). Biology/Living Environment, Math, Science & Technology. Log in Join. + J ~ ! . AGA = the . 3 0 obj ^} `. It is mandatory to procure user consent prior to running these cookies on your website. UAC = inUAU = this . Once their monster details are solved, there are analysis questions and an opportunity to draw this fiersum monster.Add another layer of fun to this ac. Each student should then be assigned a step in the procedure for making the product and form an assembly line to put the product together as a simulation for the "assembly line" that occurs in the cell when it undergoes protein synthesis. )), Auditing and Assurance Concepts and Applications (Darell Joe O. Asuncion, Mark Alyson B. Ngina, Raymund Francis A. Escala), Auditing and Assurance Services: an Applied Approach (Iris Stuart), The Law on Obligations and Contracts (Hector S. De Leon; Hector M. Jr De Leon), Conceptual Framework and Accounting Standards (Conrado T. Valix, Jose F. Peralta, and Christian Aris M. Valix), Principios de Anatomia E Fisiologia (12a. Proteins are made up of chains of amino acids. . If they answer incorrectly, they can try again. Protein Synthesis Test includes . But they are now engaged in ordering the steps for this process! Students will answer questions to color a picture (automatic coloring). If the fourth nucleotide (base) in the original DNA strand were changed from G to C, what would the base sequence of the resulting mRNA? Pre-made digital activities. . What would be the resulting amino acid sequence following the insertion in #9? b ^ As amino acids continue to bond to one another it forms a polypeptide chain that eventually results in a protein. ^R e d -D M CAG = breaks . Then the mRNA carries this informationin the form of a code to the ribosome, where protein synthesis takes place. Ed.). The tRNA is also made up of a series of bases, like mRNA. The Genetic Code (mRNA) Mysterious Monster Lab mRNA CodonAmino Acid Number UGG15 15 UCG 14 GCU 2 UUG 4 GCG 3 CCC 5 UCC 7 UUU 8 AAA 9 CCA 12 AUA 13 GGG 1UAG 6 GAU10CCU 11Figure 1 Data Table (I) Gene AGene BGene CDNAGGA CGC CGADNAAGG AGG AGCDNAACC GGA TATmRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Gene DGene EGene FDNATAT CGADNAACC GGT CTADNATTT AAC mRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Mysterious Monster Portrait Data Table (II) Gene AGene BGene CDNAGGA CGC CGCDNAGGG AGG ATC CGCDNAACC GGA TATmRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Gene DGene EGene FDNATAT CGADNATAT AGC ACCDNATTT AAA mRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Mysterious Monster Portrait Data Table (III) Gene AGene BGene CDNAGGA CGC CGADNAGGG AGG ATC CGCDNAACC GGT TATmRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Gene DGene EGene FDNAGGT AGG AAADNAATC ATC CTADNATTT AAC mRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Mysterious Monster Portrait Data Table (IV) Gene AGene BGene CDNAGGA CGC CGCDNAAGG AGG AGCDNAACC GGT TATmRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Gene DGene EGene FDNAGGT AGG AAADNATAT AGC ACCDNATTT AAA mRNAmRNAmRNAAmino Acid SequenceAmino Acid SequenceAmino Acid SequenceObserved TraitObserved TraitObserved Trait Mysterious Monster Portrait Name______________________________________________ Period _________ Analysis Questions for Assessment of Mysterious Monster Lab ANALYSIS QUESTIONS: 1. . S/he will write down the word. <>/Font<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 612 792] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> We have dog breath. 2 0 obj Protein Synthesis and Words Answer Sheet DNA: mRNA: tRNA: Sentence: If the classroom is like a cell, what would the board be? What would be the resulting amino acid sequence? Genes are the lengths of DNA molecules that determine the structure of polypeptides (the building blocks of proteins) that our cells make. . . Study Resources. endobj Formulas and functions are used in worksheets to perform calculations and analyze data. Give the base sequence of the complementary DNA strand for the strand below Original DNA strand: TAC - GCC - AGT - GGT - TCG CAC - ACTComplementary strand: 3. We are all demented puppies. [.SZu-~WB3k%_wnKG}b7@qf([]t I)C=K$e7BJR( bIcFmI1L#L/Hy`R`I;.~v-S}lky,vaK}a9 XX#=? Each group will take on the identity of a different cell type. After all, DNA cannot leave the nucleus. NOTE: This activity is updated to include an online drag and drop version with the printable format. Materials: . Biology Monster Synthesis Activity Purpose: To examine how an organism's DNA determines their phenotypes. &. . stream Students will choose a candy monster and translate its Monster DNA to an RNA sequence. I wanted a way to get them to work with the steps for protein synthesis on their own before I provide them with the notes. LZHS - Chapter 12 Protein Synthesis Lab Biology I CP 9 PROTEIN "SENTENCE" ANSWERS 1. Original DNA strand: TAC - GCC - AGT - GGT - TCG CAC - ACT mRNA (Use Us no Ts): 4. This process is known as translation. . . We have dog breath. 5. The code words in mRNA, however, are not directly recognized by the corresponding amino acids. 4 0 obj View answer key protein synthesis.pdf from SCIENCE 4777 at Flagler-palm Coast High School. In this investigation, you will simulate protein synthesis by transcribing the DNA and translating the mRNA of the imaginary CHNOPS monster. In this activity (perfect for Halloween!) UGA = aroundUGC = you . You have gotten your hands on some DNA (dont ask how) and now you need to build the proteins that make up your monster. GAC = demented . UGG = read . When using as a review, these activity cards were included with other activities and resources from each of the content we covered for the unit. B $ `M `M `M P M N h 4Q 4Q 4Q 4Q 4Q )U )U )U h h h h h h h $ {i h k n 4h }V ST )U }V }V 4h 4Q 4Q Ih /Z /Z /Z }V 4Q 4Q h /Z }V h /Z /Z Z\ b 6 \ 4Q (Q WH `M W r\ \ _h 0 h z\ , Ql }X Z Ql \ Ql \ , )U > gU , /Z U $ U )U )U )U 4h 4h Y X )U )U )U h }V }V }V }V C `M `M Mysterious Monster Lab Background Information: Genes are the units that determine inherited characteristics, such as hair color and blood type. 6. Teach protein synthesis using printable notes and then practice protein synthesis by creating a monster. GAG = puppiesGAU = and . . Using the key, each amino acid combination gives their monster a different traits. UAA = we . The process by which proteins are produced is called protein synthesis. Related products: Making a Monster. Web manhasset union free school district / homepage Web the first step in decoding genetic messages is transcription, during which a nucleotide sequence is copied from dna to rna. UUG = forUUU = life *Key to DNA Fragments (write these sequences on cards): ATGAAAAACAAGGTACACATCTAG ATGAAAAACAATTGCACGTAG ATGTAAACCACTACATAG ATGAGAAGTAGGAGAAGCATAATCTAG ATGATTCAACACATCCAGCCACATTAG ATGCCCCCGAGAAGCCCTTAG ATGCGACGCCGGCGTTAG ATGCTACTCATAGATCTGCTTTAG ATGTAAAGGGAAGACGAGTAG ATGCCCCCGGCAGCCGCGTAG ATGGCTCCGAGAGGAGGCAGAGGGTAG ATGAAAGGTAAGGTAGTCTAG ATGAAAGTGAAGGTTTAG ATGTAAAGGGAATACTATTCATAG ATGTAATCCTCGTCTCGGCGTTAG ATGATAGATCTGCTTCCGAGAAGCTAG ATGCCCCCGGAATGATGCTAG ATGTGGGTATGTCGGCGTTAG ATGTTACCGAGATTCTTGTTTTAG ATGTTATCCTCGTGGTTGTTTTAG Key for the sentences *20 Sentences: Your mother wears a rubber band. After that, students decode short genes by transcribing and translating them into traits that a monster possesses. Based on their rating, they would personalize their review by selecting the resource and order of topics. Subsequently students will translating that RNA for builds a polypeptide. The cards were a part of the detailed lesson where students had to dive deeper into protein synthesis in the next class period. 1. 64 anticodon Cards: These will be taped to the wall around your room. Please visit my store for more activities that would be great for Halloween including Genetics Monster Lab and Crazy Hat Protein Synthesis (hats can be designed for Halloween fun). As the code carried by mRNA is "read" on a ribosome, the proper tRNAs arrive in turn and give up the amino acids they carry to the growing polypeptide chain. . Are you getting the free resources, updates, and special offers we send out every week in our teacher newsletter? They transcribe and translate these genes into mRNA and amino acids. Study with Quizlet and memorize flashcards containing terms like Identify the key scientists responsible for our knowledge of DNA and their key contributions to scientific research, Describe and diagram how a nucleotide attaches to another nucleotide to build a polymer, like DNA or RNA., Explain and be able to use Chargaff's rules of complementary bases. tRNA is used in (translation/transcription). Science Quiz with 9 Mystery Pictures (Color By Answer). N, ^ N, 2 B + + + + + + + $ - h / + b + b b , " " " b b + " + " " r + T b b + ; f F i+ + , 0 N, w+ 2 x0 x0 + x0 b + $ " + + !
Hong Kong Airport Sinking,
Stockbridge Primary School Head Teacher,
When A Girl Says Thank You What Do You Say,
Modest Mother Of The Bride Dresses With Sleeves,
Articles M